Les vésicules abritant Rab7 sont porteuses du récepteur de la transferrine par la voie de sécrétion biosynthétique | Bracelet Mala

Abstrait

La voie de sécrétion biosynthétique est particulièrement difficile à étudier car elle est sous-représentée par rapport à l'abondance des autres voies de trafic intracellulaires. Ici, nous avons combiné la rétention à l'aide d'un crochet sélectif (RUSH) à une approche d'édition de gène CRISPR-Cas9 (eRUSH) et identifié les vésicules abritant Rab7 comme un compartiment intermédiaire important du transport membranaire Golgi-plasma du récepteur de la transferrine néosynthétisée (TfR) . Ces vésicules ne présentaient pas de propriétés dégradantes et n'étaient pas associées aux vésicules abritant Rab6A. Rab7A a été associé de façon transitoire à des vésicules post-Golgi néosynthétiques contenant du TfR, mais dissocié avant la fusion avec la membrane plasmique. Ensemble, notre étude révèle un rôle pour Rab7 dans la voie de sécrétion biosynthétique du TfR, mettant en évidence la diversité de la nature des vésicules sécrétoires.

INTRODUCTION

Les cellules détectent les changements environnementaux et s'adaptent en conséquence en exposant une variété de récepteurs transmembranaires à leur surface cellulaire. Les modifications post-traductionnelles et la localisation finale de ces récepteurs transmembranaires au niveau de la membrane plasmique (PM) se produisent d'abord à travers la dynamique membranaire le long de la voie de sécrétion. La voie sécrétoire est un processus constitutif ou régulé (1) transportant des protéines néosynthétisées du réticulum endoplasmique (RE) au PM. La caractérisation des mécanismes moléculaires impliqués dans ce processus cellulaire peut être utile pour le développement d'inhibiteurs ciblant la sécrétion générale ou spécifique de la cargaison (2).

Les récepteurs transmembranaires sont synthétisés et repliés dans le RE. Après synthèse, les vésicules du complexe coatomère protéique II (COPII) exportent les récepteurs incorporés vers les citernes cis-Golgi (3). Le transit de ces cargaisons à travers les piles de Golgi est toujours débattu (4, 5), bien qu'il soit bien établi que les protéines subissent des modifications post-traductionnelles successives lors de leur trafic du réseau cis-Golgi vers le réseau trans-Golgi (TGN). À l'arrivée des protéines au TGN, les cargaisons sont spécifiquement emballées et triées pour être livrées à différents organites tels que les endosomes, les lysosomes ou le PM. Les signaux de tri identifiés au niveau des régions cytosoliques des récepteurs transmembranaires conduisent au recrutement spécifique de protéines adaptatrices ou de petites guanosine triphosphatases de Rab (GTPases), nécessaires à l'incorporation de la cargaison à l'intérieur des porte-vésicules. Après bourgeonnement des membranes TGN, les protéines sont livrées à leur destination finale par transport vésiculaire. On a longtemps pensé que les récepteurs transmembranaires utilisent une voie directe du TGN au PM. Les observations des différents itinéraires de trafic suggèrent le contraire. Plusieurs études ont remarqué la présence de cargaisons à l'intérieur des compartiments endocytaires avant leur livraison au PM (68). En particulier, il a été proposé que les endosomes de recyclage Rab11-positifs soient impliqués dans la voie de biosynthèse (7, 9), mais dans l'ensemble, la nature et le sort de ces compartiments intermédiaires dans la sécrétion protéique ne sont toujours pas clairs.

Pour comprendre mécaniquement temporellement et spatialement la voie sécrétoire, quelques systèmes ont été développés. L'une des premières méthodes développées pour étudier la sécrétion protéique était la glycoprotéine thermosensible du virus de la stomatite vésiculaire (ts045VSV-G) (dix). Il implique l'incubation de cellules à une température restrictive pour bloquer le transport de ts045VSV-G à l'ER suivi d'un décalage à une température permissive inférieure pour induire la libération de la protéine vers sa voie de trafic normale (11). Cette méthode a fourni des informations analytiques précieuses sur la dynamique et la cinétique du transport du ts045VSV-G du TGN au PM.

Pour éviter les conditions de température non physiologiques et surveiller les différentes protéines de cargaison, le système RUSH (rétention par crochets sélectifs) a été élaboré (12). Il permet la rétention d'une protéine d'intérêt dans le RE puis sa libération à la demande suite à l'ajout de biotine dans le milieu cellulaire. Cette méthode s'est avérée très puissante (2, 1316), mais elle nécessite la surexpression transitoire de la protéine d'intérêt, ce qui est une limitation en cas de sécrétion régulée. De plus, la coexistence des cargaisons endogènes marquées et non marquées surexprimées pourrait conférer certaines limites à la détection temporelle quantitative d'un récepteur au niveau du PM.

Les porteurs vésiculaires impliqués dans la voie sécrétoire sont difficiles à étudier en raison de leur faible abondance à l'état d'équilibre par rapport aux vésicules endocytiques / de recyclage. Cela est particulièrement vrai pour le récepteur de la transferrine 1 (TfR), qui est largement utilisé pour les études de recyclage (pour une revue, voir (17)). La TfR est une glycoprotéine transmembranaire omniprésente qui médie l'absorption du fer par la transferrine (Tf) circulante au PM. Après la formation du complexe TfR-Tf à la surface cellulaire, le récepteur est internalisé par endocytose médiée par la clathrine et délivré aux endosomes. À l'intérieur de ces organites, le TfR se dissocie de son ligand et est recyclé à la surface cellulaire. Des études ont indiqué qu'une modification du niveau d'expression de TfR pourrait déclencher la progression du carcinome (18, 19). Les cellules cancéreuses ont exprimé une quantité élevée de TfR à leur surface cellulaire, ce qui en fait une cible anticancéreuse notable (20, 21).

Le TfR néosynthétisé arrivant au PM représente une fraction mineure du pool de TfR total exprimé à la surface cellulaire à l'état d'équilibre, et ainsi, la voie du TfR nouvellement synthétisé est particulièrement difficile à étudier. Dans cette étude, nous avons développé une approche qui combine le système RUSH avec l'édition du gène CRISPR-Cas9 que nous avons appelé «édité-RUSH» ou «eRUSH». Nous avons utilisé eRUSH pour étudier les mécanismes moléculaires impliqués dans le transport vésiculaire du TfR néosynthétisé vers le PM. TfR-eRUSH a permis le suivi spatio-temporel du trafic du TfR endogène néosynthétisé et l'identification des partenaires moléculaires impliqués dans ce processus. En particulier, nous avons souligné que Rab7A, une petite Rab GTPase généralement décrite comme un marqueur endolysosomal, est nécessaire pour l'arrivée efficace du TfR néosynthétisé au PM et a été recruté dans un sous-ensemble de vésicules contenant du TfR post-TGN, suggérant que Rab7 peut jouer un rôle dans la voie de trafic antérograde des vésicules sécrétoires.

RÉSULTATS

Génération et caractérisation du système TfR-eRUSH

La stratégie CRISPR-Cas9 que nous avons précédemment décrite (22) a été utilisé pour concevoir les cellules SUM159 dérivées du cancer du sein afin d'exprimer le TfR endogène fusionné au peptide de liaison à la streptavidine (SBP) et à la protéine fluorescente verte améliorée (EGFP). La transduction lentivirale d'une protéine chimère streptavidine-KDEL a été réalisée pour établir une lignée cellulaire stable qui retient les protéines exprimant le motif SBP du côté luminal du RE (voir (12) pour la description originale du système RUSH), et les cellules TfR-eRUSH résultantes ont ensuite été caractérisées.

Comme illustré sur la figure 1A, SBP fusionné à EGFP a été introduit dans la séquence génomique de TfR avant sa séquence de codon d'arrêt. Au niveau de l'ADN génomique, les deux allèles portaient un morceau supplémentaire d'ADN correspondant à l'étiquette SBP-EGFP (figure 1B). Au niveau des protéines, presque aucun TfR endogène n'a été détecté (à -84 kDa), tandis qu'une bande supérieure à -117 kDa est apparue, correspondant à la taille attendue de la protéine TfR-SBP-EGFP (fig. S1A). Notamment, les poids moléculaires étaient difficiles à évaluer avec précision car les échelles de différentes marques fournissaient des tailles différentes pour une bande donnée. En utilisant un anticorps anti-EGFP, nous avons pu confirmer que TfR-SBP-EGFP fonctionnait à une taille apparente de 117 kDa (fig. S1B). Selon l'échelle utilisée le long de notre étude, TfR-eRUSH apparaîtrait comme une bande de ≈98 ou 117 kDa, bien que les deux correspondent à TfR-eRUSH.

Fig. 1 Génération et caractérisation de cellules modifiées par le gène TfR-eRUSH.

(UNE) Schéma illustrant l'insertion de la séquence codant le linker-SBP-EGFP dans la région chromosomique contenant le codon stop (rouge) du TFRC gène (récepteur de la transferrine de type 1, appelé TfR). (B) L'amplification par PCR à partir de l'ADN génomique en utilisant des amorces flanquant la région du codon stop TfR a confirmé l'insertion de la séquence SBP-EGFP sur les deux allèles. (C) L'analyse par cytométrie en flux indique la quantité totale de TfR exprimée dans les cellules de type sauvage (WT) et TfR-eRUSH. MFI est représenté ± SD (10000 cellules par condition, n = 3 expériences indépendantes réalisées en double). Étudiants t test (***P <0,001). () Imagerie représentative des cellules vivantes des cellules TfR-eRUSH montrant la distribution des protéines après l'ajout de la biotine. Notez que TfR-eRUSH est au PM à partir de 23 min après l'ajout de biotine (flèches bleues). (E) Analyse par cytométrie en flux représentant la quantité de Tf-A647 liée à la surface des cellules TfR-eRUSH. Notez l'augmentation de la fluorescence Tf à partir de 20 min après l'ajout de la biotine. MFI est représenté ± SD (5000 cellules par condition, n = 3 expériences individuelles réalisées en double). (F) Images d'immunofluorescence confocales représentatives détectant l'arrivée de TfR-eRUSH au PM. Un anticorps TfR-eRUSH (vert), Tf-A647 (magenta, en haut) ou anti-TfR (TfR-Ab, en bas) a été détecté au PM à partir de 20 min après l'addition de la biotine. Barres d'échelle, 10 μm.

D'après l'immunoblot, il semblait que moins de protéines TfR-SBP-EGFP étaient exprimées dans les cellules éditées que le TfR endogène de cellules de type sauvage (WT). Cependant, la quantification de la quantité de protéines à partir de bandes de différentes tailles n'est pas fiable en raison d'une efficacité de transfert de protéines différente. Ainsi, une coloration d'anticorps anti-TfR sur des cellules WT et TfR-eRUSH a été réalisée, et l'intensité de fluorescence moyenne (MFI) de la coloration TfR a été mesurée par cytométrie en flux. Nous avons constaté que les cellules TfR-eRUSH expriment moins de TfR endogène que leur lignée cellulaire parentale (Fig. 1C).

Ensuite, nous avons réalisé une imagerie de cellules vivantes confocales tridimensionnelles sur des cellules TfR-eRUSH pour déterminer si TfR-eRUSH pourrait être efficacement retenu dans l'ER. Nous avons observé qu'en l'absence de biotine (0 min), TfR-eRUSH était retenu dans l'ER (Fig. 1D, en haut et film correspondant S1). Deux à 6 minutes après l'addition de la biotine, des vésicules ont été libérées du RE pour atteindre l'appareil de Golgi. Cette tendance a été quantifiée avec succès en mesurant le coefficient de corrélation de Pearson entre le TfR et la calnexine (marqueur ER), le GM130 (cis-Golgi) ou le TGN46 (trans-Golgi) à 0, 5 et 15 min après l'ajout de biotine (fig.S1 , C et D). Alors que l'ER a libéré la plupart de ses vésicules, un court décalage a été observé à ≈12 min avant d'observer de nombreuses vésicules sortant de l'appareil de Golgi. À 20 min, la majeure partie de TfR-eRUSH a été localisée au Golgi, et des vésicules ont été massivement libérées de cet endroit. En parallèle, PM a gagné une intensité de fluorescence TfR-eRUSH plus élevée (figure 1D, pointes de flèches bleues et film S1), indiquant que les premières quantités détectables de protéines TfR-eRUSH sont arrivées au PM 20 min après l'ajout de la biotine.

Pour mesurer quantitativement la cinétique de l'arrivée de TfR-eRUSH au PM, un test de cytométrie en flux a été optimisé (Fig. 1E). À différents moments après l'ajout de la biotine, les cellules ont été incubées à 4 ° C pour bloquer le trafic membranaire et le TfR exposé aux PM a été marqué en utilisant une transferrine recombinante couplée à une Alexa Fluor 647 (Tf-A647) (figure 1E). Nous avons remarqué qu'une petite fraction de TfR-eRUSH était déjà trouvée au PM même en l'absence de biotine (0 min), ce qui suggère soit qu'une liaison aspécifique de Tf s'est produite, soit qu'une petite quantité de TfR-eRUSH n'a pas été retenue par le crochet . Alors que le signal de fluorescence de Tf-A647 augmentait faiblement au cours des 20 premières minutes après l'addition de biotine, une augmentation de trois fois a été observée 30 minutes après l'addition de biotine. Cette cinétique a été confirmée par microscopie (Fig.1F) et est en accord avec notre imagerie de cellules vivantes (Fig.1D), dans laquelle les premières protéines TfR pouvaient être facilement détectées au PM à ≈23 min après l'addition de la biotine, puis remontées heures supplémentaires. En conclusion, notre système TfR-eRUSH représente une approche valide pour étudier le mécanisme moléculaire de la voie de sécrétion de TfR dans un modèle synchronisé endogène.

Signature moléculaire des membranes associées au TfR à l'aide de cellules TfR-eRUSH

Pour identifier les partenaires moléculaires enrichis en membranes contenant du TfR au fil du temps, des expériences de spectrométrie de masse de purification d'affinité anti-TfR (AP-LC-MS / MS) utilisant des lysats TfR-eRUSH obtenus à partir de la perturbation mécanique des cellules ont été réalisées à différents moments après la biotine. une addition. AP-LC-MS / MS a été exécuté en quadruple, et> 2000 protéines ont été identifiées dans chaque échantillon. L'analyse temporelle différentielle a identifié 557 protéines enrichies à T15 par rapport à T0 (T0-T15), alors qu'aucun enrichissement significatif en protéines n'a pu être mesuré à T30 par rapport à T15 (T15-T30). Cette absence d'enrichissement en protéines entre T15 et T30 pourrait être attribuée au manque de résolution temporelle et / ou au fait que plusieurs voies de trafic se chevauchent à ces moments, brouillant l'image finale. Analyses parallèles utilisant STRING (23) (Fig.2A) et la base de données de signatures moléculaires MSigDB (24) (Fig. 2B et tableau S1) ont été exécutés sur les listes de protéines enrichies de l'analyse différentielle T0-15. Ces méthodes ont été utilisées pour mettre en évidence les grappes de protéines et les processus biologiques associés au trafic de TfR néosynthétisé.

Fig. 2 Analyse protéomique des membranes contenant du TfR néosynthétisé.

(UNE à C) Analyse protéomique LC-MS / MS de TfR-eRUSH immunoprécipité après addition de biotine. (A) L'analyse STRING montre la carte d'interaction des protéines qui ont été enrichies à T15 par rapport à T0. Les codes de couleur mettent en évidence des groupes de protéines de fonctions connexes. (B) GO des protéines enrichies au moins 1,5 fois avec un P La valeur (<0,05) à T15 par rapport à T0 (T0-T15) a été étudiée à l'aide du logiciel en ligne GSEA. Les voies GO pertinentes et leurs valeurs FDR correspondantes sont rapportées pour chaque analyse différentielle. (C) Le tableau rapporte l'enrichissement du pli et P valeurs des protéines Rab significativement enrichies à T15 par rapport à T0 (voir tableau S2). () Des images confocales représentatives d'une seule pile z indiquent la distribution de TfR-eRUSH traité pendant 12 min avec de la biotine par rapport aux protéines endogènes Rab5, Rab6, Rab7 et Rab18 et au Ruby3-Rab10 exprimé de manière exogène. Notez que TfR-eRUSH co-distribue dans les vésicules contenant Rab7, Rab6 ou Ruby3-Rab10 (panneaux agrandis, pointes de flèches blanches). Barres d'échelle, 10 μm. Les régions agrandies à partir de carrés blancs sont représentées avec des barres d'échelle de 1 μm.

Les voies «transport intracellulaire», «localisation macromoléculaire cellulaire», «transport intracellulaire des protéines» et «sécrétion» ont été très enrichies par rapport à T0, comme le montrent les faibles valeurs du taux de fausses découvertes (FDR), un résultat attendu en raison de la nature de le test (Fig. 2B). De plus, les voies associées à «l'exocytose» (FDR = 4,75 × 10−23) et «Transport des vésicules de Golgi» (FDR = 2 × 10−15) ont également été considérablement enrichis dans une moindre mesure. Comme preuve de concept, nous avons confirmé que TMED10, une protéine identifiée comme enrichie dans nos analyses protéomiques, a été recrutée dans les vésicules sécrétoires de TfR (tableau S1 et fig. S2A). TMED10 est impliqué dans le transport antérograde médié par les vésicules COPII (25) et incorporé dans un sous-ensemble de vésicules extracellulaires (26), et ainsi, nous avons pu confirmer la pertinence de notre approche protéomique différentielle.

Les voies «processus d'oxydoréduction», «respiration cellulaire» et «organisation des mitochondries» ont également obtenu des valeurs de FDR significativement faibles. Les membranes ER et mitochondriales sont bien connues pour interagir étroitement (27), et des travaux récents ont proposé que les interactions endosomes-mitochondries sont importantes pour la libération de fer (28). Ici, les protéines associées aux mitochondries identifiées peuvent être le résultat de l'association de membranes distinctes au cours de l'immunoprécipitation plutôt que de la présence réelle de TfR dans les mitochondries. La proximité a été observée entre les mitochondries marquées par TfR-eRUSH et MitoTracker (fig. S2B). Par imagerie de cellules vivantes, nous avons visualisé certains événements rares de mitochondries «associés» à des vésicules contenant du TfR-eRUSH qui semblaient bourgeonner de l'ER, mais la résolution obtenue avec notre microscope confocal à disque tournant ne nous permet pas de tirer une conclusion significative ( fig.S2C et vidéo S2).

Les protéines régulant le trafic intracellulaire peuvent être recrutées de manière différentielle sur les membranes vésiculaires pour activer une voie de trafic spécifique. Par conséquent, nous avons choisi d'étudier plus en détail le rôle des protéines Rab car ce sont de petits régulateurs GTPase bien connus du trafic membranaire intracellulaire. Dans notre ensemble de données AP-LC-MS / MS, nous avons détecté un total de 20 protéines Rab (tableau S2). Aucune protéine Rab n'a été enrichie dans les membranes contenant TfR à T15-T30, mais 10 protéines Rab ont été significativement enrichies à T0-T15 avec un changement de pli supérieur à 1,5 fois (figure 2C). Rab1A, Rab1B et Rab18 ont été significativement enrichis à T15 par rapport à T0, un résultat attendu car ces Rabs régulent le trafic de vésicules entre l'ER et le cis-Golgi (29, 30), Rab18 étant également trouvé sur un sous-ensemble de vésicules extracellulaires (26). Rab10, Rab14 et Rab6A ont également été enrichis à T15 par rapport à T0, bien que Rab6 n'ait pas atteint la signification (tableau S2). Ces Rabs ont déjà été impliqués dans le trafic post-Golgi (14, 31, 32), indiquant en outre que notre approche est pertinente pour identifier les partenaires moléculaires impliqués dans la voie de sécrétion. Les protéines Rab12 et Rab34 ont également été identifiées, mais leur fonction n'a pas été largement étudiée. Cependant, ils peuvent tous deux jouer un rôle dans la dégradation des protéines (33, 34). Enfin, Rab7A, une protéine généralement recrutée au niveau de la membrane limitante des endosomes tardifs qui peut servir de signal de dégradation (35), était significativement enrichi à T15 par rapport à T0. Rab7A a montré l'un des scores d'enrichissement les plus élevés et le plus grand nombre de peptides uniques identifiés par LC-MS / MS (Fig. 2C et tableau S2), un résultat intrigant que nous avons cherché à explorer par la suite.

Pour corréler nos analyses protéomiques à la co-distribution réelle de TfR et Rabs, les cellules TfR-eRUSH traitées pendant 12 min avec de la biotine et la présence / absence de Rab5, Rab6, Rab7, Ruby3-Rab10 et Rab18 ont été évaluées (Fig. 2D ). Alors qu'aucune colocalisation n'a pu être observée entre TfR-eRUSH et Rab5 et Rab18, un sous-ensemble du signal Rab6, Rab7 et Rab10 était en colocalisation avec TfR-eRUSH. Ces observations qualitatives complètent les analyses protéomiques de la figure 2C et mettent en évidence Rab7 comme un partenaire inattendu intéressant impliqué dans la voie de sécrétion biosynthétique.

Rab7 est significativement enrichi sur les vésicules post-Golgi TfR-eRUSH

Pour caractériser davantage le recrutement de Rab7A sur des vésicules sécrétoires contenant du TfR, nous avons réalisé une imagerie de cellules vivantes par microscopie confocale à disque rotatif sur des cellules TfR-eRUSH transfectées avec une construction Ruby3-Rab7A sous le contrôle du faible promoteur L30 (pour minimiser la surexpression) . À partir de 7 min après l'ajout de la biotine, nous avons remarqué la présence d'un signal post-TGN TfR-eRUSH associé à des vésicules Rab7A-positives (Fig. 3A et film S3). Pour mieux apprécier si TfR-eRUSH et Rab7A ont été trouvés sur les mêmes vésicules (par opposition à deux vésicules distinctes à proximité), nous avons gonflé artificiellement ces compartiments à l'aide d'apilimod, un inhibiteur de PIKfyve (36), et nous avons pu identifier que les vésicules positives pour TfR-eRUSH étaient décorées de Rab7A au niveau de leur membrane limite (Fig. 3B). Ces données rappelaient un travail récent démontrant bien que les vésicules post-Golgi étaient positives pour Rab6 (14), et dans notre modèle, TfR-eRUSH faisait également du trafic via Rab6 (fig. S3A).

Fig. 3 Identification de Rab7 comme compartiment intermédiaire du trafic de TfR néosynthétisé.

(UNE) L'imagerie des cellules vivantes montre la localisation de TfR-eRUSH dans les cellules transfectées par Ruby3-Rab7A. Les images ont été extraites d'un seul plan à 7, 9 et 12 min après l'ajout de biotine. Notez que TfR-eRUSH (vert) co-distribue avec les vésicules positives Ruby3-Rab7A (magenta) (flèches blanches). Barres d'échelle, 5 μm. (B) Des cellules TfR-eRUSH exprimant Ruby3-Rab7A ont été imagées après un traitement à l'apilimod. Les images ont été extraites comme un seul plan à 42 minutes après l'addition de la biotine. Barre d'échelle, 10 μm. La région agrandie du carré blanc met en évidence que TfR-eRUSH (vert) localise à la membrane limite des vésicules Ruby3-Rab7A (magenta, flèches blanches). Barre d'échelle, 5 μm. (C) Des images représentatives d'une seule pile z indiquent la localisation de TfR-eRUSH par rapport aux endogènes Rab5, Rab6 et Rab7. Notez que TfR-eRUSH co-distribue avec Rab6 ou Rab7 (flèches jaunes). Barres d'échelle, 5 μm. () Le graphique représente le pourcentage de colocalisation entre TfR-eRUSH (± SEM) et le signal endogène Rab5, Rab6 ou Rab7. Les données représentent n = 30 cellules (Rab5), n = 31 cellules (Rab6), et n = 27 cellules (Rab7) par condition à partir de trois expériences indépendantes, et le test de Tukey a été exécuté pour la signification (*P <0,05 et ***P <0,001).

La quantification de l'association TfR-eRUSH avec les Rabs indiqués a ensuite été réalisée en utilisant une coloration d'anticorps sur des cellules TfR-eRUSH fixées à 15 min après l'addition de biotine. Comme prévu, le pourcentage de signal TfR-eRUSH non Golgi associé à Rab5 était très faible (9,3 ± 1,3%), tandis que l'association avec Rab6 et Rab7 était relativement élevée (31,7 ± 2,5% et 42,3 ± 3,3%, respectivement; Fig. 3, C et D). Cependant, les vésicules TfR-eRUSH hébergeraient soit Rab7A soit Rab6, mais aucune triple colocalisation post-Golgi TfR-eRUSH-Rab6-Rab7A n'a été observée (fig. S3B). Ensemble, notre analyse protéomique a révélé que plusieurs Rab sont enrichis en vésicules sécrétoires contenant du TfR et que Rab7A représente une protéine inattendue recrutée dans la voie de sécrétion néosynthétique.

Le TfR néosynthétisé s'associe aux vésicules Rab7 non dégradées

Rab7 est connu pour diriger les compartiments endosomaux tardifs vers les compartiments positifs pour Lamp1 (37). Par immunocoloration, nous avons observé qu'un sous-ensemble de TfR-eRUSH était Rab7 positif et Lamp1 négatif (Fig.4A, flèches jaunes), mais nous avons également pu voir une triple colocalisation de TfR-eRUSH, Rab7 et Lamp1 (Fig.4A, flèches blanches ). Cependant, la cartographie de l'association avec Lamp1 n'est pas suffisante pour définir les compartiments lysosomaux car une étude récente a démontré que TfR est co-trié avec Lamp1 dans les vésicules sécrétoires post-TGN en route vers le PM (16). De plus, Lamp1 a également été identifié dans notre analyse protéomique (tableau S1).

Fig. 4 TfR-eRUSH transitant par les vésicules Rab7 se localise au PM.

(UNE) Distribution TfR-eRUSH par rapport à Lamp1 et Rab7+ vésicules. Notez que différents types de vésicules sont observés: vésicules TfR-eRUSH (vertes) marquées avec Rab7 (magenta) et Lamp1 (cyan) (pointes de flèches blanches); Vésicules TfR-eRUSH marquées avec Rab7 mais sans Lamp1 (pointes de flèches jaunes). Barre d'échelle, 2 μm. (B) Imagerie de cellules vivantes de cellules TfR-eRUSH exprimant Ruby3-Rab7A en présence de LysoTracker. À 10 min après l'ajout de la biotine, notez que TfR-eRUSH-Ruby3-Rab7A+ les vésicules ne contiennent pas de LysoTracker (flèches blanches, panneaux agrandis) et sont distinctes de Ruby3-Rab7A+ (magenta) vésicules contenant uniquement LysoTracker (cyan, flèches jaunes). Barres d'échelle, 2 μm (à droite) et 10 μm (à gauche). (C) Imagerie confocale montrant la localisation de TfR-eRUSH et Rab7 en présence de DQ-BSA. Barre d'échelle, 10 μm. À 16 min après l'ajout de la biotine, les vésicules TfR-eRUSH (vert) marquées avec Rab7 (cyan) ne contiennent pas de DQ-BSA (carré 1, flèches blanches), tandis que DQ-BSA (magenta) se trouve uniquement dans Rab7+ vésicules (cyan) (carré 2, flèches blanches). Barres d'échelle, 2 μm. () Quantification de la colocalisation TfR-eRUSH avec Rab7A ou DQ-BSA. Les données représentent le pourcentage de colocalisation avec TfR-eRUSH (± SEM) avec n = 32 cellules (DQ-BSA) et n = 28 cellules (Rab7) à partir de n = 3 expériences indépendantes. Étudiants t test (***P <0,001). (E) La protéine TfR-eRUSH n'est pas dégradée lors de l'ajout de biotine, en présence de cycloheximide et de Baf A1. Actine (contrôle de charge), marqueur LMW (bas poids moléculaire). Notez que les bandes LC3-II sont plus intenses dans toutes les conditions traitées avec Baf A1, montrant un contrôle de la dégradation des protéines. (F) Imagerie confocale visualisant TfR-eRUSH-Rab7+ localisation des vésicules par rapport à LC3. À 15 min après l'ajout de la biotine, notez que TfR-eRUSH (vert) -Rab+ Les vésicules (magenta) ne co-distribuent pas avec LC3 (flèches blanches), bien que les vésicules LC3 (cyan) soient marquées avec Rab7 (flèches jaunes). Barres d'échelle, 2 et 10 μm (en haut).

Par conséquent, pour mieux déterminer si les vésicules TfR-Rab7 correspondent à des compartiments de dégradation, l'acidité du pH et l'activité protéolytique ont été mesurées (Fig. 4, B et C). Les cellules TfR-eRUSH ont été transfectées avec Ruby3-Rab7A et visualisées par imagerie en direct 10 min après l'addition de la biotine. LysoTracker a été utilisé comme lecture de l'acidité relative du pH (un signal plus brillant correspondant à un pH plus bas). Nos données montrent que les vésicules TfR-eRUSH hébergeant Rab7A avaient peu ou pas de signal LysoTracker (Fig. 4B, flèches blanches), indiquant que ces vésicules ne présentent pas les caractéristiques des compartiments protéolytiques classiques. Pour évaluer les propriétés dégradantes réelles de ces vésicules, nous avons préincubé les cellules avec DQ-BSA, une protéine d'albumine sérique bovine (BSA) qui contient des colorants fluorescents auto-désactivés qui fluorescent uniquement lorsque la BSA est clivée, et coloré les cellules avec un anti -Rab7 anticorps (Fig. 4C). La quantification du pourcentage de TfR-eRUSH colocalisant avec Rab7 ou DQ-BSA a démontré que les TfR étaient principalement trouvés dans les vésicules Rab7 dépourvues de DQ-BSA dégradé (figure 4D). Enfin, nous avons vérifié si le TfR-eRUSH était envoyé pour dégradation à l'aide de la bafilomycine A1 (Baf A1), un traitement qui prévient l'acidification lysosomale et donc la dégradation des protéines, tel qu'il est couramment utilisé pour les études d'autophagie (38). Ce traitement provoque l'accumulation de protéines rapidement dégradées, comme on pouvait s'y attendre pour LC3-II (figure 4E). En revanche, le Baf A1 n'a pas induit d'accumulation de TfR-eRUSH, ce qui suggère qu'il n'est pas envoyé à la dégradation. Pour s'assurer que l'absence de dégradation visible n'était pas due à la reconstitution néosynthétisée de TfR-eRUSH, les cellules ont été co-traitées avec Baf A1 et le cycloheximide, un inhibiteur de la traduction. Dans ce contexte, nous n'avons pas pu observer d'accumulation de TfR (figure 4E), et nous n'avons pas été en mesure de détecter les produits de dégradation en utilisant des anticorps anti-TfR ou anti-EGFP (fig. S4), suggérant que TfR-eRUSH n'est pas significativement envoyé pour dégradation. Notamment, cette expérience indique également que l'induction de eRUSH par l'ajout de biotine n'est pas accompagnée de l'induction de l'autophagie car LC3-II n'est pas régulée à la hausse (figure 4E). Pour confirmer davantage cela, une coloration LC3 a été réalisée et nous n'avons pas pu observer de coloration LC3 colocalisée avec des vésicules TfR-eRUSH positives pour Rab7 (Fig. 4F, flèches blanches), indiquant qu'elles ne correspondent pas aux autophagosomes.

Les vésicules Rab7A sont des compartiments intermédiaires assurant le transport d'un sous-ensemble de TfR-eRUSH néosynthétisé vers le PM

Pour corréler l'enrichissement au fil du temps des protéines Rab à une fonction biologique, nous avons ensuite réalisé un petit criblage à base d'ARN interférent (siRNA) ciblant 12 membres de la famille des protéines Rab. La mise au silence de 12 Rabs et d'une cible non pertinente a été réalisée en utilisant un pool de quatre siRNA par cible dans deux expériences indépendantes (figure 5A). La quantité de TfR-eRUSH au PM a été mesurée par cytométrie en flux comme sur la figure 1E, et l'enrichissement en plis de T15 sur T0 (figure 5A) a été déterminé. Comme Rabs peut affecter d'autres processus cellulaires, la quantité de TfR-eRUSH à l'état d'équilibre a été mesurée par cytométrie en flux (fig. S5A).

Fig. 5 Rab7A est impliqué dans le transport de TfR-eRUSH vers le PM.

(UNE) Test de cytométrie en flux mesurant le niveau de TfR-eRUSH au PM dans des cellules traitées avec des séquences d'ARNsi groupées ciblant 12 ARNm Rab différents et un contrôle d'ARNsi non ciblé. L'écran a été réalisé en double en n = 2 (± SD) expériences indépendantes (2000 cellules par condition). La signification a été évaluée en utilisant des appariements ratiométriques t test (*P <0,05; ***P <0,0001). (B) Test de cytométrie en flux mesurant le niveau de TfR-eRUSH au PM dans des cellules traitées avec un ARNsi spécifique à une séquence unique ciblant Rab7, RILP ou un ARN non pertinent. Chaque point représente une expérience indépendante réalisée en quadruple (10 000 cellules analysées pour chaque condition). Les barres noires représentent la moyenne des trois expériences. Ratiométrique apparié t test (*P <0,05). (C) Test de cytométrie en flux mesurant le niveau de TfR-eRUSH au PM dans des cellules TfR-eRUSH exprimant EGFP, GFP-Rab7A ou GFP-Rab7A T22N. Les données affichées sont n = 3 expériences indépendantes (± SD) (5000 cellules par condition) et appariées ratiométriques t test de signification (**P <0,001). ns, non significatif. () Les cellules TfR-eRUSH transfectées avec Ruby3-Rab7A ont été imagées par microscopie TIRF. Une image représentative extraite du film S4 est affichée à 726 s. Barre d'échelle, 10 μm. Notez que TfR-eRUSH (vert) est transporté vers le PM par la vésicule Ruby3-Rab7 (magenta) (régions recadrées). Barre d'échelle, 1 μm. (E) Les cellules TfR-eRUSH transfectées avec Ruby3-Rab6A ont été imagées par microscopie TIRF 24 heures après la transfection. Une image représentative extraite du film S5 est affichée à 860 s. Barre d'échelle, 10 μm. La vésicule Ruby3-Rab6A (magenta) portait TfR-eRUSH (vert) au PM (régions coupées). Barre d'échelle, 1 μm.

À T0-T15, la désactivation de Rab27A ou Rab6A a montré une diminution significative du TfR associé aux PM (figure 5A) par rapport au témoin d'ARNsi non pertinent. Ces résultats étaient en accord avec le rôle de ces Rabs dans la sécrétion de protéines (14, 39, 40), validant notre approche. En revanche, le silence Rab10 n'avait aucun effet détectable sur le trafic de TfR vers le PM, alors que nous l'avons trouvé enrichi dans notre analyse protéomique (Fig. 2C). Cependant, la désactivation de Rab7A a montré une inhibition significative de l'arrivée de TfR-eRUSH au PM (figure 5A). Ces données ont été confirmées en utilisant une seule séquence d'ARNsi ciblant Rab7A, tandis que le knockdown de RILP (Rab7-interacting lysosomal protein), un effecteur Rab7 (41), n'a eu aucun effet significatif sur l'arrivée de TfR (Fig. 5B). Les expressions des protéines étaient effectivement régulées à la baisse (fig. S5B). En raison de l'effet potentiel hors cible des approches siRNA, nous avons surexprimé la protéine négative dominante Rab7A T22N (fig. S5C) et montré qu'elle induisait également une réduction significative de l'arrivée de TfR au PM (figure 5C). De plus, dans des expériences utilisant une construction Rab7 résistante aux siRNA, nous avons trouvé un sauvetage partiel de l'arrivée de TfR au PM (fig. S6). Bien que la tendance soit conforme à nos observations précédentes, les différences ne sont pas significatives. Cela peut s'expliquer par la difficulté à contrôler le taux de protéine Rab7 résistante aux siRNA, dont la surexpression perturbe le trafic membranaire intracellulaire normal (42). Bien que Rab7A soit connu pour son rôle dans le trafic endocytaire rétrograde vers les endosomes tardifs et les lysosomes (35), cela est cohérent avec nos données AP-LC-MS / MS (Fig. 2C), indiquant en outre que Rab7 pourrait participer au transport des vésicules TfR post-TGN.

To directly determine the fate of the Rab-harboring post-Golgi TfR-eRUSH vesicles, total internal reflection fluorescence (TIRF) microscopy was performed on cells transfected with Ruby3-Rab7A (Fig. 5D and movie S4) or Ruby3-Rab6A (Fig. 5E and movie S5). At 12 min after biotin addition, the arrival of TfR-eRUSH was observed in the evanescent TIRF field. We monitored events during which Rab7-positive vesicles became positive for TfR-eRUSH for several seconds (from 704 to 736 s; Fig. 5D) before the two signals segregated again, followed by a TfR-eRUSH signal burst, indicative of PM fusion (734 s). In sharp contrast, Ruby3-Rab6A remained associated to TfR-eRUSH vesicles until fusion occurred (848 to 868 s; Fig. 5E).

These observations indicate that Rab7A vesicles are used as intermediate compartments in TfR trafficking after its release from the TGN. Unlike Rab6A, Rab7A vesicles do not accompany neosynthesized TfR all the way to the PM, and thus, other partners are likely involved downstream of the Rab7-TfR vesicle trafficking.

DISCUSSION

Description of the different pathways mediating transport of neosynthesized receptors to the PM has been studied for decades. Being able to specifically observe the anterograde pathway has always been a challenge as its visualization overlaps with other trafficking routes, including the overrepresented endocytosis and recycling pathways. To visualize protein transport under physiological conditions, we combined the RUSH system to the CRISPR-Cas9 technology. Using TfR as a model, we generated a stable cell line expressing endogenous levels of the receptor fused to EGFP and the SBP tag required for the RUSH system. TfR function and trafficking are well described, but the partners involved in neosynthesized TfR trafficking to the PM are not well characterized. The eRUSH approach was coupled to quantitative proteomics experiments and cytometry-based screening to identify the molecular partners involved in the neosynthetic pathway of the TfR. Unexpectedly, we observed that a significant subset of TfR transits through Rab7-positive vesicles during its trafficking to the PM.

The trafficking kinetics of neosynthesized TfR-eRUSH was similar to the overexpressed TfR in the RUSH system that was previously described to reach the PM ≈30 min after biotin addition (16). The advantage of our eRUSH is that no or minimal amount of “ghost” untagged proteins are expressed in TfR-eRUSH, allowing quantitative single-molecule counting and whole-TfR functional analysis. Moreover, eRUSH also represents a powerful knock-away system, similar to other methods (43), but without the problem of competition with the WT version of the protein coexpressed in the cell. In contrast to classic complementary DNA (cDNA) transfection, CRISPR-Cas9–based gene editing of TfR allows the conservation of the regulatory genomic environment of the gene. This parameter is particularly important for proteins such as TfR, as its transcriptional/translational regulation is a finely regulated process (44, 45).

Using AP-LC-MS/MS, we could track the local TfR environment at different times after biotin addition and identify proteins co-distributing with TfR-extracted membranes. Whereas previous siRNA-based screens studying the secretory pathway allowed the identification of previously unidentified partners (46), our eRUSH-based proteomics is based on a noninterfering approach, and thus, it provides new complementary information to previous studies. Pathway analysis revealed relevant enriched biological processes and less expected ones. An enriched proportion of mitochondrial proteins at 15 min after biotin addition was observed. We propose that this result is due to ER-mitochondria membrane contacts sites and may not be relevant to the biosynthetic pathway of TfR.

Some Rabs can act together in the exocytosis process, such as Rab6 and Rab8 (47) or Rab3 and Rab27 (48). We detected >35% of TfR-eRUSH–containing vesicles harboring a Rab6-positive staining (Fig. 3D), but our data suggest, however, that Rab6 and Rab7 do not intervene at the same stage of the secretory pathway and/or in the same type of vesicular transport, as shown by the absence of overlap between the Rab6 and Rab7 staining (fig. S3B). Moreover, by TIRF microscopy (Fig. 5, D and E), we noticed two different processes of TfR transport using Rab6A or Rab7A, further indicating that these two Rabs likely correspond to two distinct secretory routes.

Combining results from the AP-MS/MS and siRNA screen, only one Rab was significantly standing out: Rab7. Rab7 is mostly known to mediate cargo trafficking between late endosomes and lysosomes (35), and it was unexpected to find it involved in the neosynthetic pathway. By electron microscopy, a group observed the presence of neosynthesized TfR inside endosome-like structures (6). Moreover, it was demonstrated that Rab7 was not involved in recycling of TfR at the PM, as depletion of Rab7A had no effect on TfR relocalization to the PM (35), and thus, it is unlikely that our observations would be the result of marginal PM-associated TfR endocytosis at early times after biotin addition.

A legitimate thought is to believe that the post-Golgi Rab7-decorated TfR-eRUSH vesicles correspond to a degradative pathway. However, extensive analyses of these vesicles show that they were mostly negative/dim to LysoTracker, they are neither proteolytically active (DQ-BSA marker) nor autophagosomes, and autophagy is not induced by the biotin treatment (Fig. 4). Moreover, the full membranes of the Western blot analysis show no degradative product, further demonstrating that TfR-eRUSH vesicles harboring Rab7 are not degradative, and actually, direct evidence supports PM targeting of these vesicles (Fig. 5D). However, the function of these vesicles as compared to the Rab6-positive vesicles remains to be determined.

A recent study by Chen et al. (16) indicated that neosynthesized TfR was sorted out with the Lamp1 protein in vesicles exiting the TGN, but they did not search for the presence of Rab7. Here, we show that a heterogeneous subset of TfR-containing vesicles exists, harboring Rab7 or Lamp1 or both. At this stage, it is difficult to ascertain the function of each subset, but one could envision that the triple-positive vesicles correspond to TfR and Lamp1 neosynthesized proteins cotransported into Rab7-positve vesicles. They also showed that these vesicles were devoid of the mannose-6P receptor (M6PR), which was used as a marker for the Golgi-to-endosome route (49). In our hands, we also found that M6PR was absent from the TfR-eRUSH vesicles harboring Rab7 (fig. S7). They concluded that the TfR+ Lamp1+ vesicles were bona fide secretory vesicles en route to the PM. In our study, a subset of vesicles containing TfR-eRUSH and Lamp1 was also decorated by Rab7 at time points corresponding to TGN exit. These vesicles may correlate with the ones described by Chen et al. (16), but their comprehensive composition and function in the secretory pathway remain to be fully determined.

We suggest that Rab7 could act as an intermediate compartment for neosynthesized TfR transport. Whether this Rab7 compartment corresponds to a bona fide late endosome remains unclear, as it does not exhibit the hallmarks of an acidic, pro-degradative vesicle. However, the neosynthesized TfR could traffic to specialized late endosomes destined to reach the PM, similar to exosome-containing multivesicular bodies. In this regard, Rab27A is a regulator of exosome secretion (40), and its silencing strongly prevents TfR arrival to the PM (Fig. 5A). It was previously shown that Rab7 and Rab27A may act one after another during the maturation process of melanosome (50). Future work should emphasize the link between the various Rabs along the biosynthetic secretory pathway.

Although the specific role of Rab7 on these secretory vesicles remains to be determined, one could hypothesize that Rab7 regulates the trafficking of cargos with specific posttranslational modifications. Alternatively, this pathway could transport cargos dedicated to specific PM domains. Recently, Rab7 has been mapped not only to late endosomes and lysosomes but also at the ER, TGN, and mitochondrial membranes, a localization maintained by the retromer complex (51), and thus, it is likely that Rab7 exerts pleiotropic roles.

MATERIALS AND METHODS

Cell culture

SUM159 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F-12 GlutaMAX (GIBCO), supplemented with 5% fetal bovine serum (FBS; Dominique Dutscher), penicillin-streptomycin (500 μg/ml; GIBCO), hydrocortisone (1 μg/ml; Sigma-Aldrich), insulin (5 μg/ml; Sigma-Aldrich), and 10 mM Hepes (GIBCO) (complete medium). Cells were maintained at 37°C and 5% CO2. For cytometry-based assay, Tf-A647 was diluted in DMEM/F-12 GlutaMAX (GIBCO), supplemented with 0.1% BSA, penicillin-streptomycin (500 μg/ml; GIBCO), hydrocortisone (1 μg/ml; Sigma-Aldrich), insulin (5 μg/ml; Sigma-Aldrich), and 10 mM Hepes (GIBCO; pH 7.0) (Tf medium).

Generation of the TfR-eRUSH CRISPR-Cas9–edited cell line

For gene editing of the SUM159 cells to fuse the GGSGGSGGS spacer, the SBP, and EGFP sequences to the C terminus of TfR, a CRISPR-Cas9 strategy was used as previously described (22, 52). Briefly, three genetic tools were cotransfected using the transfection reagent TransfeX (American Type Culture Collection): (i) a plasmid coding for CRISPR-associated protein 9 (Cas9), a template plasmid; (ii) a linear polymerase chain reaction (PCR) product used to transcribe the trans-activating crispr RNA (tracrRNA) and guide RNA targeting ATAGCTTCCATGAGAACAGC (corresponding to a region near the genomic TfR stop codon) under the control of the human U6 promoter; (iii) a donor DNA construct (serving as template during homologous recombination) corresponding to the spacer, SBP, and EGFP sequences flanked by ≈800 base pairs (bp) upstream and 800 bp downstream of the TfR stop codon. Single-cell sorting of EGFP-positive cells was performed, and homo/heterozygotic monoclonal cell lines expressing endogenous TfR-eRUSH were screened by PCR using the forward primer 5′-CTCACACGCTGCCAGCTTTA-3′ and the reverse primer 5′-TTCAGCAGAGACCAGCCCTT-3′.

A clone that was edited on both alleles was further transduced with a lentiviral vector coding the puromycin resistance gene and for the “hook” consisting of the streptavidin protein linked to the KDEL motif (12). Upon puromycin selection, the SUM159 TfR-eRUSH cells were expanded and stocks for the original tube were maintained in liquid nitrogen.

Plasmids

The Ruby3-Rab7A (Addgene plasmid #135651), Ruby3-Rab6A (Addgene plasmid #135653), and Ruby3-Rab10 cDNA constructs cloned into pBS vectors under the control of the weak promoter L30 were generated by the Montpellier Genomic Collection (MGC). The GFP-Rab7A (#61803) and GFP-Rab7A T22N (#28048) plasmids were obtained from Addgene. The siRNA-resistant GFP-Rab7A construct was generated using the forward primer 5′-AGTATTCGATGTGACTGCCCCCAACAC-3′ and the reverse primer 5′-AGTACACAGCAGTCTGCACCTCTGTAGAAG-3′. Site-directed mutagenesis was carried out using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s instructions.

Antibodies and treatments

For immunofluorescence, primary antibodies used were mouse anti-GM130 (1:1000; BD Biosciences), sheep anti-TGN46 (1:1000; Bio-Rad), rabbit anti-calnexin (1:1000; Elabscience), mouse anti-Lamp1 (1:100; BD Biosciences), rabbit anti-Rab7 (1:250; Cell Signaling Technology), rabbit anti-Rab5 (1:1000; Cell Signaling Technology), rabbit anti-Rab6 (1:1000; Cell Signaling Technology), rabbit anti-Rab18 (1:200; Sigma-Aldrich), rabbit anti-TMED10 (1:500; Sigma-Aldrich), mouse anti-LC3 (1:1000; Sigma-Aldrich), and mouse anti-TfR (1:250; Miltenyi Biotec). Secondary antibodies used were Alexa Fluor 568 donkey anti-sheep (1:1000; Life Technologies), Alexa Fluor 568 donkey anti-rabbit (1:1000; Thermo Fisher Scientific), and Alexa Fluor 647 donkey anti-mouse (1:1000; Thermo Fisher Scientific). Antibodies used for immunoblotting were rabbit anti-TfR (1:1000; Aviva Systems Biology), mouse anti–β-actin (Abcam), mouse anti-GFP (1:1000; Sigma-Aldrich), rabbit anti-RILP (1:1000; Novus Biologicals), mouse anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (1:1000; Genetex), and rabbit anti-LC3 (1:1000; Sigma-Aldrich). Secondary antibodies used for immunoblotting were goat anti-mouse immunoglobulin G (IgG) horseradish peroxidase (HRP) antibody (1:10,000; Jackson ImmunoResearch) and goat anti-rabbit IgG HRP antibody (1:10,000; Jackson ImmunoResearch). Probes used for immunofluorescence were membrane-permeable MitoTracker Orange CM-H2TMRos (Molecular Probes) used for 30 min at 100 nM to label mitochondria, LysoTracker Red (Life Technologies) for acidic compartments used for 30 min at 50 nM, DQ-Red BSA (Life Technologies) incubated for 6 hours at 10 μg/ml in complete medium, and DAPI (4′,6-diamidino-2-phenylindole) (1:1000; Sigma-Aldrich) used to stain the nucleus. For flow cytometry, Tf-A647 (Molecular Probes) was used at 10 μg/ml and mouse TfR antibody (10 μg/ml). For Western blotting, cells were treated for 4 hours with cycloheximide (50 μg/ml) and 100 nM Baf A1 before 30-min biotin incubation for TfR-eRUSH release. Cells were treated for 30 min with 40 nM apilimod before biotin treatment.

Cytometry-based RUSH assay

To detect PM-localized TfR, 50,000 SUM159 cells were plated in 24-well plates and incubated in complete medium containing avidin (0.2 μg/ml; Sigma-Aldrich) for 48 hours. To initiate TfR release, cells were incubated in a fresh complete medium containing 40 μM biotin (Sigma-Aldrich) for the indicated amount of time at 37°C and 5% CO2. Then, cells were placed on ice, the medium was replaced with ice-cold phosphate-buffered saline (PBS), and cells were maintained at 4°C for 10 min. To measure the amount of TfR at the PM, cells were incubated for 30 min with Tf (10 μg/ml) coupled to an Alexa Fluor 647 (Tf-A647; Molecular probes) diluted in Tf medium. For acid wash treatment, cells were incubated in 0.1 M glycine (pH 3.0) for 2 min and then washed two times with cold PBS. In the absence of acid wash, unbound Tf-A647 was washed two times with cold PBS and cells were detached with 5 mM EDTA. Cells were collected and centrifuged at 500g for 5 min at 4°C. Cell fixation was carried out with 4% paraformaldehyde (PFA) for 15 min at room temperature, and after two washes, they were resuspended in a flow cytometry buffer (PBS (pH 7.0), 0.5% BSA, and 0.5 mM EDTA). Samples were run on a CytoFLEX (Beckman Coulter) or NovoCyte (ACEA Biosciences) flow cytometer equipped with 488- and 640-nm lasers and four-filter set.

Small interfering RNA

A pool of four different siRNAs for each of the 12 selected Rab proteins and a nontargeting siRNA control were purchased as a custom-made siGENOME SMARTpool cherry-pick library (Dharmacon, Horizon Discovery; see details in table S3). Forty thousand SUM159 cells were seeded in 48-well plates, and on the next day, 3 pmol of siRNA was transfected using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cells were further incubated for 48 hours in complete medium in the presence of avidin (0.28 μg/ml). The day of the experiment, cells were incubated at different time points with 40 μM biotin. The cytometry-based assay for PM-localized TfR described above was used for sample analysis.

For single siRNA, siRNA control, siRNA Rab7, or siRNA RILP was purchased from Ambion, Thermo Fisher Scientific. Fifty thousand cells were seeded in 24-well plates, and the next day, 11 pmol of siRNA was transfected using Lipofectamine 3000 (Thermo Fisher Scientific).

Overexpression assays

In 24-well plates, 50,000 TfR-eRUSH cells were seeded in complete medium in the presence of avidin (2 μg/ml). The next day, 0.5 μg of DNA containing the different plasmids (GFP, GFP-Rab7, or GFP-Rab7 T22N) was transfected using jetPRIME (Polyplus) according to the manufacturer’s instructions. Cells were incubated for 24 hours in complete medium containing avidin (2 μg/ml). The day of the experiment, the cytometry-based assay was carried out. Data were analyzed on the GFP cell population of high intensity corresponding to the transfected cells.

MS-based quantitative proteomics

Sample preparation. The immunoprecipitated samples were resuspended in Laemmli buffer, and the antibody-conjugated magnetic beads were removed. Protein concentration was determined using the RC-DC protein assay (Bio-Rad) according to the manufacturer’s instructions, and a standard curve was established using BSA. For each sample, 8 μg of protein lysate was concentrated on a stacking gel by electrophoresis. The gel bands were cut, washed with ammonium hydrogen carbonate and acetonitrile, reduced, and alkylated before trypsin digestion (Promega). The generated peptides were extracted with 60% acetonitrile in 0.1% formic acid followed by a second extraction with 100% acetonitrile. Acetonitrile was evaporated under vacuum, and the peptides were resuspended in 16 μl of H2O and 0.1% formic acid before nanoLC-MS/MS analysis.

NanoLC-MS/MS analysis. NanoLC-MS/MS analyses were performed on a nanoACQUITY Ultra-Performance LC system (Waters, Milford, MA) coupled to a Q-Exactive Plus Orbitrap mass spectrometer (Thermo Fisher Scientific) equipped with a nanoelectrospray ion source. Samples were loaded into a Symmetry C18 precolumn (0.18 mm × 20 mm, 5 μm particle size; Waters) over 3 min in 1% solvent B (0.1% FA in acetonitrile) at a flow rate of 5 μl/min followed by reversed-phase separation (ACQUITY UPLC BEH130 C18, 200 mm × 75 μm inside diameter, 1.7 μm particle size; Waters) using a binary gradient ranging from 1 to 35% of solvent A (0.1% FA in H2O) and solvent B at a flow rate of 450 nl/min. The mass spectrometer was operated in data-dependent acquisition mode by automatically switching between full MS and consecutive MS/MS acquisitions. Survey full-scan MS spectra (mass range of 300 to 1800) were acquired in the Orbitrap at a resolution of 70,000 at 200 m/z (mass/charge ratio) with an automatic gain control (AGC) fixed at 3 × 106 ions and a maximal injection time set to 50 ms. The 10 most intense peptide ions in each survey scan with a charge state of ≥2 were selected for MS/MS. MS/MS spectra were acquired at a resolution of 17,5 K at 200 m/z, with a fixed first mass at 100 m/z, AGC was set to 1 × 105, and the maximal injection time was set to 100 ms. Peptides were fragmented in the Higher-energy collisional dissociation (HCD) cell by higher-energy collisional dissociation with a normalized collision energy set to 27. Peaks selected for fragmentation were automatically included in a dynamic exclusion list for 60 s. All samples were injected using a randomized and blocked injection sequence (one biological replicate of each group plus pool in each block). To minimize carryover, a solvent blank injection was performed after each sample. A sample pool comprising equal amounts of all protein extracts was constituted and regularly injected four times during the course of the experiment, as an additional quality control (QC). Protein identification rates and coefficient of variation (CV) monitoring of this QC sample revealed very good stability of the system: 2207 of the 2271 (97%) identified proteins showed a CV value lower than 20% considering all four injections.

Data interpretation. Raw MS data processing was performed using MaxQuant software (v1.5.8.3 (53)). Peak lists were searched against a composite database including all Homo sapiens protein sequences extracted from UniProtKB-SwissProt (version April 2019; taxonomy ID: 9606) using the MSDA (Mass Spectrometry Data Analysis) software suite (54). MaxQuant parameters were set as follows: MS tolerance set to 20 parts per million (ppm) for the first search and 5 ppm for the main search, MS/MS tolerance set to 40 ppm, maximum number of missed cleavages set to 1, carbamidomethyl (C) set as fixed modification, and acetyl (protein N terminus) and oxidation (M) set as variable modifications. FDRs were estimated on the basis of the number of hits after searching a reverse database and were set to 5% for both peptide spectrum matches (minimum length of seven amino acids) and proteins. Data normalization and protein quantification were performed using the label-free quantification option implemented in MaxQuant (53) using a “minimal ratio count” of two. The “match between runs” option was enabled using a 2-min time window after retention time alignment. All other MaxQuant parameters were set as default.

To be validated, proteins must be identified in all four replicates of one condition at least. The imputation of the missing values and differential data analysis were performed using the open-source ProStaR software (55). Two runs of imputation were applied: The “SLSA” mode was applied for the POVs (partially observed values) and the “del quantile” for the MEC (missing in the entire condition). Pairwise comparisons were performed using a Limma t test on protein intensities. P value calibration was performed using the pound calibration method, and the FDR threshold was set at 5%. The complete proteomics dataset is available via ProteomeXchange (56, 57) with identifier PXD010576.

Gene ontology analysis

Gene set enrichment analysis (GSEA) was run on the protein lists found to be significantly enriched at least 1.5 times in T0-T15, T0-T30, and T15-T30 using the online molecular signature database MSigDB v6.2 (24). Significantly enriched gene ontology (GO) pathways related to relevant “biological process” were extracted with their FDR. Table S1 summarizes the relevant GO pathways associated to the T0-T15 time points. No significant enrichment was found at T0-T30 and T15-T30.

Fluorescence microscopy

Fifty thousand cells were plated on 24-well plates containing 12-mm cover glasses (Electron Microscopy Sciences) and incubated for 48 hours in complete medium containing avidin (1 μg /ml). For the different eRUSH assays, cells were incubated at 12, 15, and 30 min in complete medium containing 40 μM biotin. Cells were fixed with 4% PFA for 20 min at room temperature and permeabilized for 15 min with PBS containing 0.1% Triton X-100 (Sigma-Aldrich) and 0.5% BSA (Euromedex). Cells were subsequently incubated for 1 hour at room temperature with different primary antibodies (see the “Antibodies and treatments” section) and then 1 hour with secondary antibodies and DAPI staining. Cells were mounted with Mowiol 4-88 (Sigma-Aldrich). For LC3 staining, cells were fixed with formalin (Sigma-Aldrich) for 15 min at room temperature and then with cold methanol for 5 min at −20°C, before antibody staining in PBS containing 0.1% saponin and 1% FBS.

Images were taken with an Axio Observer Z1 inverted microscope (Zeiss) mounted with a CSU-X1 spinning disk head (Yokogawa), a back-illuminated Electron-multiplying charge-coupled device (EMCCD) camera (Evolve, Photometrics), and 63× (1.45 numerical aperture (NA)) or 100× (1.45 NA) oil objectives (Zeiss). Images were processed with Fiji software and presented as single z-stack for visualization of the co-distribution.

Live imaging

About 250,000 cells seeded on 35-mm #1.5 glass-bottom dishes (Ibidi) or on 25-mm cover glasses (Electron Microscopy Sciences) were transfected using jetPRIME (Polyplus Transfection) according to the manufacturer’s instructions. The dish was placed on the microscope stage and maintained in a dark atmosphere–controlled chamber at 37°C and 5% CO2. Live-cell imaging was performed using an Axio Observer Z1 inverted microscope (Zeiss) mounted with a CSU-X1 spinning disk head (Yokogawa), a back-illuminated EMCCD camera (Evolve, Photometrics), and a 100× (1.45 NA) oil objective (Zeiss) controlled by VisiView v.3.3.0 software (Visitron Systems). For TIRF microscopy, live imaging was performed with a TIRF PALM STORM microscope from Nikon using a back-illuminated EMCCD camera (Evolve 512, Photometrics) and a 100× APO (1.49 NA) oil objective controlled by MetaMorph and an iLas2 FRAP/TIRF module (BioVision Technologies). The TIRF angle was chosen to obtain a calculated evanescent field depth of <100 nm. Acquisition was performed from 5 to 25 min after biotin addition. Images were processed with FiJi software and presented as single z-stack for visualization of the co-distribution.

Preparation of protein extracts

Cells (250,000 per well) were seeded in a six-well plate in complete medium containing avidin (1 μg/ml) for 48 hours. After incubation with biotin for 0 or 30 min, cells were washed three times with ice-cold PBS and lysed with ice-cold radioimmunoprecipitation assay buffer (150 mM sodium chloride, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM tris (pH 8.0), and protease inhibitor (Promega)). Cells were placed on ice for 10 min and spun at 10,000g for 20 min at 4°C. The supernatant was collected and subjected to the Pierce BCA Assay Kit (Thermo Fisher Scientific).

Western blot analysis

A total of 20 or 40 μg of protein lysates were run on Bolt 4 to 12% Bis-Tris plus gels (Thermo Fisher Scientific), and proteins were transferred to nitrocellulose membranes. Nitrocellulose membranes were blocked with 5% (w/v) milk in PBS-T (PBS (pH 7.4) and 0.05% Tween 20) for 15 min. Primary antibodies (refer to the “Antibodies and treatments” section) were incubated for 1 hour at room temperature or overnight at 4°C in PBS-T containing 5% milk. Secondary antibodies were incubated for 1 hour at room temperature. After washing with PBS-T, nitrocellulose membranes were incubated with Clarity Max Western ECL Substrate (Bio-Rad). The specific proteins were visualized with the ChemiDoc imaging system (Bio-Rad).

Software analysis

Image processing was performed using either the Fiji upgrade of ImageJ (58) or Imaris software v9.2 (Bitplane, Oxford Instruments). Quantifications for colocalization measurements were performed using Imaris software v9.2 (Bitplane, Oxford Instruments). Statistical analyses were performed with Microsoft Excel 2016 and Prism v7.04 (GraphPad). Flow cytometry analysis was done using FlowJo software v10.4.2 (FlowJo LLC). Raw MS data were first analyzed using MaxQuant v1.6.0.16. Differential proteomics data analysis was performed using DAPAR v1.10.3 and ProStaR v1.10.4.

Acknowledgments: We acknowledge the imaging facility MRI, member of the National Infrastructure France-BioImaging. We thank L. Espert and colleagues for helpful discussions and sharing reagents related to autophagy. We thank M. Bonazzi and colleagues for advice and reagents related to Rab7. We thank T. Kirchhausen for supportive discussions. GFP-Rab7A was a gift from G. Voeltz (Addgene plasmid #61803), and EGFP-Rab7A T22N was a gift from Q. Zhong (Addgene plasmid #28048). Funding: MS-related work was financially supported by the “Agence Nationale de la Recherche” (ANR) and the French Proteomic Infrastructure (ProFI; ANR-10-INBS-08-03). This work was supported by the Ministry of Science and Technology of the People’s Republic of China (2018YFA0507101) and the National Natural Science Foundation of China (31770900). Laboratory work in the laboratory of F.P. is supported by the Institut Curie, the Centre National de la Recherche Scientifique, the Labex CelTisPhyBio (ANR-10-LABX-62-IBEID and ANR-10-IDEX-0001-02 PSL), the Agence Nationale de la Recherche (ANR-17-CE13-0021-02, ANR-17-CE15-0025-02), and La Fondation pour la Recherche Médicale (EQU201903007925). This work was supported by the IdEx Université de Strasbourg, the Agence Nationale de la Recherche (ANR-18-CE13-0003-01), and an ATIP-AVENIR starting grant to R.G. Author contributions: M.S.D. and R.G. conceived the experiments. M.S.D., I.C., C.D., V.L., and R.G. generated and characterized the TfR-eRUSH cell line. M.S.D., I.C., and R.G. performed flow cytometry. I.C. conducted the siRNA-based assays. M.S.D. and R.G. performed the microscopy analyses. F.D. and A.H. conducted MS, and F.D., S.C., C.C., and R.G. analyzed the proteomics data. E.S. generated constructs for imaging. G.B. and F.P. provided technical and conceptual support. R.G. and M.S.D. wrote the manuscript. R.G., M.S.D., C.D., F.D., and C.C. edited and commented on the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. The MS proteomics data have been deposited in the ProteomeXchange Consortium database with the identifier PXD010576. Additional data related to this paper may be requested from the authors.

Les malas sont de magnifiques ornement composés de 108 perles que les Boudhistes et les Hindous utilisent depuis des siècles pour méditer. Il est employé pour compter les mantras (les prières en sanskrit) selon groupes de 108 répétitions. La récitation d’un mantra est utilisée comme une forme de méditation.
Selon les origines du yoga, un mantra est un mot ainsi qu’à une phrase en sanskrit qui a des pouvoirs spéciaux qui transforment la conscience, satisfont les désirs ou bien promeuvent la guérison.

La « guirlande de méditation » est ainsi la traduction littérale de ce mot d’origine sanskrit, la langue des textes religieux hindous et bouddhistes, ce qui renvoie à son usage première le « Japa » (type particulier de méditation où le fidèle récite des textes sacrés). Dès lors, le japa mala a pour usage à la récitation de prières mantras pendant séances de méditation.
Le Mala sert principalement à compter la répétition de récitations de mantras a l’intérieur du bouddhisme pendant des prières et pendant la méditation, tandis que dans l’hindouisme ce bracelet Mala « Rudraksha » est un accessoire de protection aux bienfaits spirituelles constitué de graines d’Elaeocarpus ganitrus de tailles différentes.

Le bracelet Mala vous permet, avec l’aide de ses perles, d’évaluer votre temps de méditation. Il est une valeur objective de la durée de chacune de vos séances.

Le bracelet Mala peut aussi vous aider à étudier votre patience et votre concentration. La patience et la méditation sont de de deux ans ans bienfaits obligé à la méditation. Ce sont aussi des qualités indéniables dans votre vie de tous les jours et dans votre développement personnel et spirituel.

Le fait d’égrener chaque germe permet de se recentrer. Le bracelet Mala est un mécanisme qui rappelle à l’essentiel en toutes circonstances.

Il est le symbole du parcours de ses chemins profonds. Il permet que ces chemins seront être traversés à l’infini en dévoilant toujours de nouveaux trésors. C’est une façon d’apprendre que la connaissance de soi-même est sans limite. Le développement personnel est l’art de total une vie. Il est probable de profiter de l’énergie du Mala tibétain pour mettre d’or point sa séance. Certains fioriture Mala permettent d’accéder plus rapidement à un état de sérénité profond. Ils sont aussi propices d’or bien-être et à la relaxation.

Dans le yoga, le bracelet Mala peut aussi devenir un point de fixation. Il donne l’opportunité de rester concentré, et surtout d’effectuer abstraction de l’environnement.

Les bijoux bracelet Yoga ont souvent des vertus lithothérapie grâce aux pierres semi précieuses. Le pouvoir des pierres est très puissant sur le corps.
Voici les pierres naturelles donnant des énergies positives :
• Quartz
• Cristal
• Jaspe dalmatien
• Cornaline
• Pierre de soleil
• Agate noire
• Diamant
• Citrine
• Obsidienne
• Calcédoine
• Pierres de lave
• Pierre d ambre
• Oeil de faucon
• Jaspe jaune
• Pierre de protection
• Pierre de lune
• Turquoise
• Améthyste
• Lapis lazuli
• Aventurine
• Oeil de tigre

Ceux qui examinent les chakras décrivent comme des organes vivants. Ils auraient pour fonction la contrôle de « l’énergie » entre différentes parties du corps, et entre le corps, la terre et l’univers. Soumis aux aléas de l’individu, elles présenteraient des symptômes de rigidité et pourquoi pas d’affaissement, d’encombrement ainsi qu’à de perte de vitalité. Ils communiqueraient entre eux et seraient capables de se compenser mutuellement. Réciproquement, une action « d’harmonisation actif » ( tel que le mission bracelet ) aurait des répercussions sur les facultés de l’individu.